Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRP
(Plasmid #41841)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41841 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 6577
  • Modifications to backbone
    Part of the SV40 Promotor (Leaving the SV40 Enhancer) through the Neomycin resistance gene in pCDNA3 was removed by digesting with BstZ17 I & Avr II (filled in to blunt), and self-ligating. This was digested with Not I then partially with Xmn I, and the MoMLV 3’ UTR was PCR cloned in with Not I & Xmn I. This was digested with Nru I & BamH I, and PCRed CMV/MoMLV 5'LTR cut with Nru I & BspE I, and PCRed LNGFR cut with BspE I & BamH I were cloned together. This was digested with BamH I & Not I, and PCRed CMV cut with BamH I & HinD III, and annealed oligonucleotde Polylinker with HinD III & Not I overhangs were ligated together. LNGFR was removed with BspE I & BamH I and replaced with PCRed puromycin resistance cut with Age I & Bgl II.
  • Vector type
    Mammalian Expression, Retroviral
  • Promoter CMV
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer AAGCAGAGCTCGTTTAGTGAA
  • 3′ sequencing primer CTTGCAAAATGGCGTTACTTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The retroviral insert in this vector was made by PCRing CMV and MoMLV elements from pCLNCX (Naviaux et al. J Virol. 1996 August; 70(8): 5701–5705.) and recloning them into a modified pCDNA3 backbone
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRP was a gift from Eicke Latz (Addgene plasmid # 41841 ; http://n2t.net/addgene:41841 ; RRID:Addgene_41841)
  • For your References section:

    ASC speck formation as a readout for inflammasome activation. Stutz A, Horvath GL, Monks BG, Latz E. Methods Mol Biol. 2013;1040:91-101. doi: 10.1007/978-1-62703-523-1_8. 10.1007/978-1-62703-523-1_8 PubMed 23852599