pRP_ASC-LmCerulean
(Plasmid #41840)

• Depositing Lab: Eicke Latz
• Publication: Stutz et al Methods Mol Biol. 2013;1040:91-101. doi: 10.1007/978-1-62703-523-1_8.

Backbone

• Vector backbone: pRP_LmCerulean
• Backbone size w/o insert (bp): 7332
• Total vector size (bp): 7911
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: apoptosis-associated speck-like protein containing CARD
• Alt name: ASC; PYCARD; TMS; TMS1; CARD5; TMS-1
• Species: H. sapiens (human)
• Insert Size (bp): 585
• Mutation: Stop Codon removed
• GenBank ID: NM_013258
• Entrez Gene: PYCARD (a.k.a. ASC, CARD5, TMS, TMS-1, TMS1)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCerulean (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: AAGCAGAGCTCGTTTAGTGAA

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry