-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePCDNA5
-
Backbone manufacturerINVITROGEN
- Backbone size w/o insert (bp) 5000
-
Modifications to backboneKozak Consensus Sequence added
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHalotag 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)885
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternate plasmid name: pCDNA5-KGH2
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HA-EGFP-HaloTag2 was a gift from Craig Crews (Addgene plasmid # 41742 ; http://n2t.net/addgene:41742 ; RRID:Addgene_41742) -
For your References section:
Small-molecule hydrophobic tagging-induced degradation of HaloTag fusion proteins. Neklesa TK, Tae HS, Schneekloth AR, Stulberg MJ, Corson TW, Sundberg TB, Raina K, Holley SA, Crews CM. Nat Chem Biol. 2011 Jul 3;7(8):538-43. doi: 10.1038/nchembio.597. 10.1038/nchembio.597 PubMed 21725302