pMALp2x-CARP-1
(Plasmid
#41727)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMAL-p2x
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 6695
- Total vector size (bp) 7484
-
Vector typeBacterial Subcloning
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameclam ADP-ribosylating protein-1
-
Alt nameCARP-1
-
Alt nameNAD+:DNA(guanine-N2)-ADP-D-ribosyltransferase
-
SpeciesMeretrix lamarckii
-
Insert Size (bp)789
-
Mutationdeleted 5'-UTR nucleotides 1-64
-
GenBank IDAB266110
- Promoter pMB1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gtaaaacgacggccag
- 3′ sequencing primer ggtcgtcagactgtcgatgaagcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A CARP-1 coding sequence is inserted in "an opposite direction" to the tac promoter of the vector, due to the toxicity to Escherichia coli. This plasmid is for subcloning,; not for expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMALp2x-CARP-1 was a gift from Koji Okamoto (Addgene plasmid # 41727 ; http://n2t.net/addgene:41727 ; RRID:Addgene_41727) -
For your References section:
Purification and molecular cloning of a DNA ADP-ribosylating protein, CARP-1, from the edible clam Meretrix lamarckii. Nakano T, Matsushima-Hibiya Y, Yamamoto M, Enomoto S, Matsumoto Y, Totsuka Y, Watanabe M, Sugimura T, Wakabayashi K. Proc Natl Acad Sci U S A. 2006 Sep 12;103(37):13652-7. Epub 2006 Aug 31. 10.1073/pnas.0606140103 PubMed 16945908