Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

4xCSL-luciferase
(Plasmid #41726)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41726 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    RSV-TATA pGL2
  • Backbone manufacturer
    Dr. D. Towler (Washington University, St. Louis)
  • Modifications to backbone
    From pGL2-Basic: Rous sarcoma virus TATA box inserted to reduce basal luciferase activity.
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    4xCSL binding sites
  • Alt name
    4xCBS
  • Mutation
    Contains a multimerized high affinity CSL binding site (4 x CGTGGGAA)
  • Tag / Fusion Protein
    • Firefly luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII/BamHI (destroyed during cloning)
  • 3′ cloning site Bglll/BamHI (destroyed during cloning)
  • 5′ sequencing primer F1ori-F (GTGGACTCTTGTTCCAAACTGG)
  • 3′ sequencing primer LucNRev
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Plasmid CBF1/pGL2-GLO TATA CAT from Samuel Speck (Emory University, Atlanta, GA) Plasmid RSV-TATA pGL2 from Dwight A. Towler (Washington University School of Medicine, St. Louis, MO)
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The 4xCSL-luciferase reporter was constructed from the CBF1/pGL2-GLO TATA CAT plasmid, a gift from Dr. S. Speck. A fragment containing the multimerized high affinity CSL sites (4× CGTGGGAA) was excised by BamHI digest and ligated into a BglII/BamHI-digested RSV-TATA pGL2 vector, a gift from Dr. D. Towler. This modified vector has a TATA box from Rous sarcoma virus inserted into the pGL2-basic vector (Promega) to reduce the basal luciferase activity. Construct was sequenced for verification.

Alternate plasmid name: 4xCBS-luciferase

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    4xCSL-luciferase was a gift from Raphael Kopan (Addgene plasmid # 41726 ; http://n2t.net/addgene:41726 ; RRID:Addgene_41726)
  • For your References section:

    Murine notch homologs (N1-4) undergo presenilin-dependent proteolysis. Saxena MT, Schroeter EH, Mumm JS, Kopan R. J Biol Chem. 2001 Oct 26;276(43):40268-73. Epub 2001 Aug 22. 10.1074/jbc.M107234200 PubMed 11518718