Hes5-Luc
(Plasmid #41724)

• Depositing Labs: Ryoichiro Kageyama, Raphael Kopan
• Publication: Nishimura et al Genomics. 1998 Apr 1;49(1):69-75.

Backbone

• Vector backbone: pGL2-Basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5597
• Total vector size (bp): 6470
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Hes5 Promoter
• Alt name: Hes5
• Alt name: hairy and enhancer of split 5 Promoter
• Alt name: hairy and enhancer of split 5
• Species: M. musculus (mouse)
• Insert Size (bp): 873
• Mutation: Contains the murine Hes5 promoter (-800 to +73)
• GenBank ID: NC_000070.6
• Entrez Gene: Hes5 (a.k.a. bHLHb38)
• Promoter: Hes5
• Tag / Fusion Protein:
  • Firefly luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: F1ori-F (GTGGACTCTTGTTCCAAACTGG)
• 3′ sequencing primer: LucNrev

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry