-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41724 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL2-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5597
- Total vector size (bp) 6470
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHes5 Promoter
-
Alt nameHes5
-
Alt namehairy and enhancer of split 5 Promoter
-
Alt namehairy and enhancer of split 5
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)873
-
MutationContains the murine Hes5 promoter (-800 to +73)
-
GenBank IDNC_000070.6
- Promoter Hes5
-
Tag
/ Fusion Protein
- Firefly luciferase (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer F1ori-F (GTGGACTCTTGTTCCAAACTGG)
- 3′ sequencing primer LucNrev (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hes5-Luc was a gift from Ryoichiro Kageyama & Raphael Kopan (Addgene plasmid # 41724 ; http://n2t.net/addgene:41724 ; RRID:Addgene_41724) -
For your References section:
Structure, chromosomal locus, and promoter of mouse Hes2 gene, a homologue of Drosophila hairy and Enhancer of split. Nishimura M, Isaka F, Ishibashi M, Tomita K, Tsuda H, Nakanishi S, Kageyama R. Genomics. 1998 Apr 1;49(1):69-75. 10.1006/geno.1998.5213 PubMed 9570950