MSCVhygro-F-G9adSET
(Plasmid #41722)

• Purpose: Retroviral expression of human G9a mutant in mammalian cells
• Depositing Lab: Kai Ge
• Publication: Wang et al EMBO J. 2012 Nov 23. doi: 10.1038/emboj.2012.306.

Backbone

• Vector backbone: pmscvhyg
• Backbone manufacturer: mscvhyg
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 10000
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: G9adset
• Alt name: EHMT2
• Species: H. sapiens (human)
• Insert Size (bp): 3100
• Entrez Gene: EHMT2 (a.k.a. BAT8, C6orf30, G9A, GAT8, KMT1C, NG36)
• Tag / Fusion Protein:
  • flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (destroyed during cloning)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: n/a

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Relative to NCBI reference NP_006700.3, Addgene NGS identified the following variants in the plasmid insert: T55N, V387A, and D577G.