MSCVhygro-F-G9a
(Plasmid #41721)

• Purpose: Retroviral expression of human G9a in mammalian cells
• Depositing Lab: Kai Ge
• Publication: Wang et al EMBO J. 2012 Nov 23. doi: 10.1038/emboj.2012.306.

Backbone

• Vector backbone: pMSCVhyg
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 10600
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: G9a
• Alt name: EHMT2
• Species: H. sapiens (human)
• Insert Size (bp): 3600
• Entrez Gene: EHMT2 (a.k.a. BAT8, C6orf30, G9A, GAT8, KMT1C, NG36)
• Tag / Fusion Protein:
  • flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (destroyed during cloning)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: n/a

Resource Information

• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

G9A insert contains N665K relative to reference sequence BC018718.1. Depositor states that this mutation should not affect function.