rbcLS-pMAL-2px
(Plasmid #41621)

• Depositing Lab: Ichiro Matsumura
• Publication: Parikh et al Protein Eng Des Sel. 2006 Mar;19(3):113-9. Epub 2006 Jan 19.

Backbone

• Vector backbone: pMAL-p2x
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 6721
• Total vector size (bp): 7318
• Modifications to backbone: MBP (malE) removed by NdeI-SalI digestion
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): INVαF´
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: rbcL/rbcS
• Alt name: rbcL
• Alt name: rbcS
• Alt name: ribulose 1,5-bisphosphate carboxylase/oxygenase
• Species: Synechococcus elongatus PCC 6301
• Insert Size (bp): 1844
• Promoter: Ptac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: Tac Promoter (GAGCGGATAACAATTTCACACAGG)
• 3′ sequencing primer: M13_pUC_fwd

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The rbcL/rbcS genes, which are adjacent in the Synechococcus PCC6301 chromosome, were PCR amplified together from whole cells using Vent polymerase and primers:

5'SrbcL (5'-GGGCCC[CATATG]CCCAAGACGCAATCTGCCGCAGG-3')

and

3'SrbcS (5'-CCCGGG[GAGCTC]AGGCTTTAGTAGCGGCCGGGACG-3').

The rbcL/rbcS PCR product was cloned into pMAL-2px using restriction enzymes NdeI and SacI (bracketed), and sequenced to confirm its wild-type identity.

Plasmid Features:

Type Start End Name

GENE 2 1420 rbcLS
GENE 1511 1846 rbcS
GENE 1862 2062 'malE-MCS-lacZa
REGION 2047 2453 terminators
GENE 2564 3424 ampR
REGION 3466 3979 M13 ori
REGION 4090 4678 pMB1 ori
GENE 5108 5299 rop
GENE 5807 6955 lacIQ
REGION 7198 7225 Ptac