Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

rbcLS-pMAL-2px
(Plasmid #41621)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41621 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMAL-p2x
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 6721
  • Total vector size (bp) 7318
  • Modifications to backbone
    MBP (malE) removed by NdeI-SalI digestion
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    INVαF´
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    rbcL/rbcS
  • Alt name
    rbcL
  • Alt name
    rbcS
  • Alt name
    ribulose 1,5-bisphosphate carboxylase/oxygenase
  • Species
    Synechococcus elongatus PCC 6301
  • Insert Size (bp)
    1844
  • Promoter Ptac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer Tac Promoter (GAGCGGATAACAATTTCACACAGG)
  • 3′ sequencing primer M13_pUC_fwd
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The rbcL/rbcS genes, which are adjacent in the Synechococcus PCC6301 chromosome, were PCR amplified together from whole cells using Vent polymerase and primers:

5'SrbcL (5'-GGGCCC[CATATG]CCCAAGACGCAATCTGCCGCAGG-3')

and

3'SrbcS (5'-CCCGGG[GAGCTC]AGGCTTTAGTAGCGGCCGGGACG-3').

The rbcL/rbcS PCR product was cloned into pMAL-2px using restriction enzymes NdeI and SacI (bracketed), and sequenced to confirm its wild-type identity.

Plasmid Features:

Type Start End Name

GENE 2 1420 rbcLS
GENE 1511 1846 rbcS
GENE 1862 2062 'malE-MCS-lacZa
REGION 2047 2453 terminators
GENE 2564 3424 ampR
REGION 3466 3979 M13 ori
REGION 4090 4678 pMB1 ori
GENE 5108 5299 rop
GENE 5807 6955 lacIQ
REGION 7198 7225 Ptac

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    rbcLS-pMAL-2px was a gift from Ichiro Matsumura (Addgene plasmid # 41621 ; http://n2t.net/addgene:41621 ; RRID:Addgene_41621)
  • For your References section:

    Directed evolution of RuBisCO hypermorphs through genetic selection in engineered E.coli. Parikh MR, Greene DN, Woods KK, Matsumura I. Protein Eng Des Sel. 2006 Mar;19(3):113-9. Epub 2006 Jan 19. 10.1093/protein/gzj010 PubMed 16423843