-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCI
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4006
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCaspase-1
-
Alt nameCASP1
-
Alt nameICE
-
Alt nameCASP1 caspase 1, apoptosis-related cysteine peptidase
-
SpeciesH. sapiens (human)
-
GenBank IDNM_033292.3 NP_150634.1
-
Entrez GeneCASP1 (a.k.a. ICE, IL1BC, P45)
- Promoter CMV immediate-early enhancer/promoter
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer chim-int-F (TCTTACTGACATCCACTTTGCC)
- 3′ sequencing primer EBV-rev (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-Caspase 1 was a gift from Kate Fitzgerald (Addgene plasmid # 41552 ; http://n2t.net/addgene:41552 ; RRID:Addgene_41552) -
For your References section:
AIM2 recognizes cytosolic dsDNA and forms a caspase-1-activating inflammasome with ASC. Hornung V, Ablasser A, Charrel-Dennis M, Bauernfeind F, Horvath G, Caffrey DR, Latz E, Fitzgerald KA. Nature. 2009 Mar 26. 458(7237):514-8. 10.1038/nature07725 PubMed 19158675