pEF-Bos TRAM Flag
(Plasmid #41551)

• Depositing Labs: Kate Fitzgerald, Doug Golenbock
• Publication: Fitzgerald et al J Exp Med. 2003 Oct 6;198(7):1043-55. Epub 2003 Sep 29.

Backbone

• Vector backbone: pEF-Bos
• Backbone manufacturer: Mizushima and Nagata (Osaka Bioscience Institute, Japan, 1990) (PMID: 1698283)
• Backbone size w/o insert (bp): 5685
• Total vector size (bp): 6400
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TRAM
• Alt name: Toll-IL-1-resistance (TIR) domain-containing adaptor-inducing IFN-beta (TRIF)-related adaptor molecule
• Alt name: TICAM2
• Alt name: toll-like receptor domain-containing adaptor molecule 2
• Species: H. sapiens (human)
• Insert Size (bp): 700
• GenBank ID: NM_021649.6 NP_067681.1
• Entrez Gene: TICAM2 (a.k.a. MyD88-4, TICAM-2, TIRAP3, TIRP, TRAM)
• Promoter: EF1a
• Tags / Fusion Proteins:
  • Flag (C terminal on backbone)
  • 6xHis (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: EF-1aF
• 3′ sequencing primer: G-CSF-R (GATGGGGAACACTGCTGTTTA)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositing lab generated pEF-Bos Tram Flag from a human peripheral blood mononuclear cell (PBMC) complementary DNA library by PCR amplification and cloning. It was cloned with XhoI at the 5' end and BamHI at the 3' end. NotI can be used at the 3' end to excise the tagged CDS. The construct also contains a HIS tag.