pEF-Bos TRIF Flag
(Plasmid #41550)

• Depositing Labs: Kate Fitzgerald, Tom Maniatis
• Publication: Fitzgerald et al Nat Immunol. 2003 May;4(5):491-6.

Backbone

• Vector backbone: pEF-Bos
• Backbone manufacturer: Mizushima and Nagata (Osaka Bioscience Institute, Japan, 1990) (PMID: 1698283)
• Backbone size w/o insert (bp): 5685
• Total vector size (bp): 7900
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Trif
• Alt name: TIR domain–containing adapter-inducing IFN
• Alt name: TICAM-1
• Species: H. sapiens (human)
• Insert Size (bp): 2200
• GenBank ID: NM_182919.3 NP_891549.1
• Entrez Gene: TICAM1 (a.k.a. IIAE6, MyD88-3, PRVTIRB, TICAM-1, TRIF)
• Promoter: EF1a
• Tags / Fusion Proteins:
  • Flag (C terminal on backbone)
  • 6xHis (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: Esp3/BamHI (destroyed during cloning)
• 5′ sequencing primer: EF-1aF
• 3′ sequencing primer: G-CSF-R (GATGGGGAACACTGCTGTTTA)

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositing lab generated pEF-Bos TRIF Flag from a human peripheral blood mononuclear cell (PBMC) complementary DNA library by PCR amplification and cloning. Due to the facts that the fusion site into the FLAG/His is a BamHI site and that TRIF has both an internal BamHI and a BglII site, the depositing lab used an Esp3I site to create an overhang compatible with the 3' BamHI site. XhoI was used for cloning at the 5' end. NotI can be used at the 3' end to excise the tagged CDS. The construct also contains a HIS tag.

Esp3I has the following cutting pattern:
CGTCTCNNNNN
GCAGAGN

In the case of TRIF, the fusion results in a junction that resembles a BglII/BamHI fusion, and is therefore unable to be recut.