TAL-BBL1-ID21
(Plasmid
#41519)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41519 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1Δ4728-2101
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 2698
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePolylinker flanked by 2 Mva1269I cut sites
-
SpeciesSynthetic
-
Insert Size (bp)59
- Promoter SV40
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ASK-FN2 (CGGCCTTTTTACGGTTCCTG)
- 3′ sequencing primer pBABE_3 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TAL-BBL1-ID21 was a gift from Veit Hornung (Addgene plasmid # 41519 ; http://n2t.net/addgene:41519 ; RRID:Addgene_41519) -
For your References section:
A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes. Schmid-Burgk JL, Schmidt T, Kaiser V, Honing K, Hornung V. Nat Biotechnol. 2012 Dec 16. doi: 10.1038/nbt.2460. 10.1038/nbt.2460 PubMed 23242165