Skip to main content
Addgene

pLIX_403
(Plasmid #41395)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41395 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Cloning Grade DNA 41395-DNA.cg Limited Stock Available, 3 units left
2 µg of cloning grade DNA in Tris buffer
1 $105

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    Addgene plasmid 41393
  • Backbone size (bp) 9396
  • Vector type
    Mammalian Expression, Lentiviral ; Gateway Destination vector, Doxycycline inducible
  • Promoter TRE promoter, Tet ON
  • Selectable markers
    Puromycin
  • Tag / Fusion Protein
    • V5 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid expresses puro-2A-rtTA-VP16 from the PGK promoter, so it can be used as an 'all-in-one' dox on system.

Alternate plasid name:
TRE-gateway-V5; PGK-puro-2A-rtTA

Information for Cloning Grade DNA (Catalog # 41395-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $105 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLIX_403 was a gift from David Root (Addgene plasmid # 41395 ; http://n2t.net/addgene:41395 ; RRID:Addgene_41395)

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out these options:

Learn More
Commonly requested with: