pBabe(SV40)-Cytochrome C-GFP
(Plasmid #41184)

• Depositing Lab: Douglas Green
• Publication: Goldstein et al Nat Cell Biol. 2000 Mar;2(3):156-62.

Backbone

• Vector backbone: pBabe
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 5330
• Modifications to backbone: Puromycin resistance gene was cut out with HindIII and ClaI, and replaced with Cytochrome C-GFP fragment
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cytochrome C-GFP
• Alt name: cytog
• Species: M. musculus (mouse)
• Promoter: SV40

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: ctttatccagccctcac
• 3′ sequencing primer: accctaactgacacacattcc

Resource Information

• Supplemental Documents:
  • CytoG_Plasmid_Guide.pdf

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry