pCytochrome C-GFP
(Plasmid #41182)

• Depositing Lab: Douglas Green
• Publication: Goldstein et al Nat Cell Biol. 2000 Mar;2(3):156-62.

Backbone

• Vector backbone: pGFP-N1
• Backbone manufacturer: Clontech
• Total vector size (bp): 5015
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cytochrome C
• Alt name: cytog
• Species: M. musculus (mouse)
• Insert Size (bp): 330
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (destroyed during cloning)
• 3′ cloning site: BglII (destroyed during cloning)
• 5′ sequencing primer: acgtgtcgacctaatatgggtgatgttgaaaaagg
• 3′ sequencing primer: acagatctttctcattagtagcctttttaag

Resource Information

• Supplemental Documents:
  • CytoG_Plasmid_Guide.pdf
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry