Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCytochrome C-GFP
(Plasmid #41182)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41182 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGFP-N1
  • Backbone manufacturer
    Clontech
  • Total vector size (bp) 5015
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cytochrome C
  • Alt name
    cytog
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    330
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (destroyed during cloning)
  • 3′ cloning site BglII (destroyed during cloning)
  • 5′ sequencing primer acgtgtcgacctaatatgggtgatgttgaaaaagg
  • 3′ sequencing primer acagatctttctcattagtagcctttttaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCytochrome C-GFP was a gift from Douglas Green (Addgene plasmid # 41182 ; http://n2t.net/addgene:41182 ; RRID:Addgene_41182)
  • For your References section:

    The coordinate release of cytochrome c during apoptosis is rapid, complete and kinetically invariant. Goldstein JC, Waterhouse NJ, Juin P, Evan GI, Green DR. Nat Cell Biol. 2000 Mar;2(3):156-62. 10.1038/35004029 PubMed 10707086