pcold-6xHis-HRV3Csite-DmLoqsPA
(Plasmid
#41093)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcold1
-
Backbone manufacturerTakara
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7200
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLoquacious-PA
-
Alt nameLoqs-PA
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1260
-
Entrez Geneloqs (a.k.a. Dmel_CG6866, CG6866, Dmel\CG6866, LOQS, Loqs, Loqs-PD, LqPD, R3D1, R3D1-L, R3D1-S, TRBP, cg6866, dRax, loq, r3d1)
-
Tag
/ Fusion Protein
- 6xHis-HRV3Csite (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTAATACACCATGAATCACAAAGTG
- 3′ sequencing primer AATAAAAAAATCCCCGCCAAATGGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcold-6xHis-HRV3Csite-DmLoqsPA was a gift from Phillip Zamore (Addgene plasmid # 41093 ; http://n2t.net/addgene:41093 ; RRID:Addgene_41093) -
For your References section:
Dicer Partner Proteins Tune the Length of Mature miRNAs in Flies and Mammals. Fukunaga R, Han BW, Hung JH, Xu J, Weng Z, Zamore PD. Cell. 2012 Oct 9. pii: S0092-8674(12)01171-3. doi: 10.1016/j.cell.2012.09.027. 10.1016/j.cell.2012.09.027 PubMed 23063653