-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-HA
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4350
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetherin
-
Alt nameBST-2
-
Alt namebone marrow stromal cell antigen 2
-
Alt nameCD317
-
SpeciesH. sapiens (human)
-
Insert Size (bp)550
-
GenBank IDNM_004335.2 NP_004326.1
-
Entrez GeneBST2 (a.k.a. CD317, HM1.24, TETHERIN)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CMV-F, LNCX
- 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid pCR2.1/tetherin (template for Tetherin gene) provided by Paul Bieniasz.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was generated by PCR cloning of the tetherin cDNA into backbone plasmid pCMV-HA (Clontech). The tetherin gene was amplified from a source provided by Paul Bieniasz (pCR2.1/tetherin) using the following primers:
1) SalTetherin-f (ACGCGTCGACCATGGCATCTACTTCGTATGAC)
2) XhoTetherin-r (CCGCTCGAGTCACTGCAGCAGAGCGCTGAG)
The 550 bp fragment was amplified, digested, and cloned into pCMV-HA using SalI and XhoI sites. The sequence was verified by sequencing throughout the amplified fragement, and shown to express HA-tetherin protein by Western blot.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HA.Tetherin was a gift from Paul Spearman (Addgene plasmid # 41068 ; http://n2t.net/addgene:41068 ; RRID:Addgene_41068) -
For your References section:
CAML does not modulate tetherin-mediated restriction of HIV-1 particle release. Ali MS, Hammonds J, Ding L, Spearman P. PLoS One. 2010 Feb 2;5(2):e9005. 10.1371/journal.pone.0009005 PubMed 20126395
Map uploaded by the depositor.
