pFLuc190UGA
(Plasmid #41046)

• Depositing Lab: James Inglese
• Publication: Auld et al Proc Natl Acad Sci U S A. 2009 Mar 3;106(9):3585-90. Epub 2009 Feb 10.

Backbone

• Vector backbone: pRL-CMV
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 2900
• Total vector size (bp): 4884
• Modifications to backbone: Replaced the Renilla reniformas luciferase (Rluc) gene found in pRL-CMV with that of P. pyralis from pGL3-Basic
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Firefly luciferase 190UGA
• Mutation: in-frame UGA stop codon was created at codon 190
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GCTAGAGTACTTAATACGACTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This construct was prepared and sequenced by GenScript Corporation.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A mutation that produced an in-frame UGA stop codon was created at codon 190 in the FLuc coding region of pFLucWT to produce the construct reffered to as pFLuc190UGA (mutation at codon 190; 571AC->TG).