-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41036 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCDNA4
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5021
- Total vector size (bp) 12086
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFVIII
-
Alt nameFull length FVIII
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7065
-
GenBank IDNM_000132
-
Entrez GeneF8 (a.k.a. AHF, DXS1253E, F8B, F8C, FVIII, HEMA, THPH13)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ATAGGGAGACCCAAGCTGGC
- 3′ sequencing primer TGTTCGAATGGGTGACCTCG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA4/Full length FVIII was a gift from Robert Peters (Addgene plasmid # 41036 ; http://n2t.net/addgene:41036 ; RRID:Addgene_41036) -
For your References section:
Biochemical and functional characterization of a recombinant monomeric Factor VIII-Fc fusion protein. Peters RT, Toby G, Lu Q, Liu T, Kulman JD, Low SC, Bitonti AJ, Pierce GF. J Thromb Haemost. 2012 Dec 4. doi: 10.1111/jth.12076. 10.1111/jth.12076 PubMed 23205847
