-
PurposeRetroviral expression of GFP in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV-N-Flag-HA-IRES-PURO
- Backbone size w/o insert (bp) 6500
-
Vector typeMammalian Expression, Retroviral ; Gateway Destination vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Alt nameGreen Fluorescent Protein
-
SpeciesA. victoria
-
Insert Size (bp)715
- Promoter LTR-driven expression
-
Tags
/ Fusion Proteins
- Flag (N terminal on backbone)
- HA (N terminal on backbone)
- IRES Puro (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer Harper-MSCV (CAGCCCTCACTCCTTCTCTAGG)
- 3′ sequencing primer pCDH-rev (GCATTCCTTTGGCGAGAG) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-N-Flag-HA-GFP was a gift from Wade Harper (Addgene plasmid # 41034 ; http://n2t.net/addgene:41034 ; RRID:Addgene_41034) -
For your References section:
Defining the human deubiquitinating enzyme interaction landscape. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Cell. 2009 Jul 23. 138(2):389-403. 10.1016/j.cell.2009.04.042 PubMed 19615732