pIRES-Neo-HA-cdc25C5
(Plasmid
#40967)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRESneo3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5260
- Total vector size (bp) 6513
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecdc25C5
-
Alt namecdc25C
-
Alt nameCell Division Cycle 25 Homolog C
-
Alt nameM-phase inducer phosphatase 3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1253
-
GenBank IDNM_022809.2 NP_073720.1
-
Entrez GeneCDC25C (a.k.a. CDC25, PPP1R60)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer synth-int-R (ggagtactcaccccaacagc) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIRES-Neo-HA-cdc25C5 was a gift from Olivier Gavet (Addgene plasmid # 40967 ; http://n2t.net/addgene:40967 ; RRID:Addgene_40967)