Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pIRES-Neo-HA-cdc25C5
(Plasmid #40967)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40967 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pIRESneo3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5260
  • Total vector size (bp) 6513
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cdc25C5
  • Alt name
    cdc25C
  • Alt name
    Cell Division Cycle 25 Homolog C
  • Alt name
    M-phase inducer phosphatase 3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1253
  • GenBank ID
    NM_022809.2 NP_073720.1
  • Entrez Gene
    CDC25C (a.k.a. CDC25, PPP1R60)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer synth-int-R (ggagtactcaccccaacagc)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIRES-Neo-HA-cdc25C5 was a gift from Olivier Gavet (Addgene plasmid # 40967 ; http://n2t.net/addgene:40967 ; RRID:Addgene_40967)