Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKXUa1-HA-ATBF1
(Plasmid #40926)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40926 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKXUa1
  • Backbone manufacturer
    Kaiming Xu (Emory University)
  • Backbone size w/o insert (bp) 6750
  • Total vector size (bp) 19000
  • Modifications to backbone
    a linker containing HA-tag was inserted
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ATBF1
  • Alt name
    ZFHX3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    11112
  • GenBank ID
    L32832.1 AAC14462.1
  • Entrez Gene
    ZFHX3 (a.k.a. ATBF1, ATBT, ATFB8, C16orf47, SCA4, ZFH-3, ZNF927)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer GCAAATGGGCGGTAGGCGTGTA
  • 3′ sequencing primer GACCTTGCATTCCTTTGGCGAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKXUa1-HA-ATBF1 was a gift from Jin-Tang Dong (Addgene plasmid # 40926 ; http://n2t.net/addgene:40926 ; RRID:Addgene_40926)
  • For your References section:

    ATBF1 inhibits estrogen receptor (ER) function by selectively competing with AIB1 for binding to the ER in ER-positive breast cancer cells. Dong XY, Sun X, Guo P, Li Q, Sasahara M, Ishii Y, Dong JT. J Biol Chem. 2010 Oct 22;285(43):32801-9. Epub 2010 Aug 18. 10.1074/jbc.M110.128330 PubMed 20720010