-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepFastBac1
-
Vector typeBacterial Expression, Insect Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse vasopressin promoter
- Promoter mouse vasopressin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba I (not destroyed)
- 3′ cloning site Xba I (not destroyed)
- 5′ sequencing primer CCTTGCTGTTCTTCTACGGCA
- 3′ sequencing primer aagtttaacaacaacaattgca (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The following mutations are known and do not effect function: C6978-,AT722--, -5958C, G5896C, G5850-, C5834G, C5819-, A5682T, C5709-, -5647T, -5497C, T5371C.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2.0VPI.EGFP was a gift from Harold Gainer (Addgene plasmid # 40868 ; http://n2t.net/addgene:40868 ; RRID:Addgene_40868) -
For your References section:
Cell-Type Specific Expression of the Vasopressin Gene Analyzed by AAV Mediated Gene Delivery of Promoter Deletion Constructs into the Rat SON In Vivo. Ponzio TA, Fields RL, Rashid OM, Salinas YD, Lubelski D, Gainer H. PLoS One. 2012;7(11):e48860. doi: 10.1371/journal.pone.0048860. Epub 2012 Nov 14. 10.1371/journal.pone.0048860 PubMed 23155418