Skip to main content
Addgene

p2.0VPI.EGFP
(Plasmid #40868)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40868 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pFastBac1
  • Vector type
    Bacterial Expression, Insect Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse vasopressin promoter
  • Promoter mouse vasopressin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba I (not destroyed)
  • 3′ cloning site Xba I (not destroyed)
  • 5′ sequencing primer CCTTGCTGTTCTTCTACGGCA
  • 3′ sequencing primer aagtttaacaacaacaattgca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The following mutations are known and do not effect function: C6978-,AT722--, -5958C, G5896C, G5850-, C5834G, C5819-, A5682T, C5709-, -5647T, -5497C, T5371C.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2.0VPI.EGFP was a gift from Harold Gainer (Addgene plasmid # 40868 ; http://n2t.net/addgene:40868 ; RRID:Addgene_40868)
  • For your References section:

    Cell-Type Specific Expression of the Vasopressin Gene Analyzed by AAV Mediated Gene Delivery of Promoter Deletion Constructs into the Rat SON In Vivo. Ponzio TA, Fields RL, Rashid OM, Salinas YD, Lubelski D, Gainer H. PLoS One. 2012;7(11):e48860. doi: 10.1371/journal.pone.0048860. Epub 2012 Nov 14. 10.1371/journal.pone.0048860 PubMed 23155418