Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOTIII.EFGP.IGR3.6
(Plasmid #40866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40866 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PBSKII
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 9000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MOUSE OXYTOCIN GENE
  • Alt name
    OT
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    6000
  • GenBank ID
    NC_000068.7
  • Promoter mouse oxytocin promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CAAGCGCGCAATTAACCCTCACTA
  • 3′ sequencing primer CGGCCAGTGAGCGCGCGTAAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The following mutations are known and do not effect function:
C4566T, GA4556C-, C insert at 3495, A3013C, G2750C.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTIII.EFGP.IGR3.6 was a gift from Harold Gainer (Addgene plasmid # 40866 ; http://n2t.net/addgene:40866 ; RRID:Addgene_40866)
  • For your References section:

    Regulatory domains in the intergenic region of the oxytocin and vasopressin genes that control their hypothalamus-specific expression in vitro. Fields RL, House SB, Gainer H. J Neurosci. 2003 Aug 27;23(21):7801-9. PubMed 12944509