Skip to main content
Addgene

p3.5VPIII.EGFP.IGR2.1
(Plasmid #40865)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40865 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSE280
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 11974
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mouse vasopressin gene
  • Alt name
    Mouse AVP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    9000
  • GenBank ID
    NC_000068.7
  • Entrez Gene
    Avp (a.k.a. Vp, Vsp)
  • Promoter AVP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CAAATATTCTGAAATGAGCT
  • 3′ sequencing primer CTTTATCAGAAGCCAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

the following mutations are known and do not effect plasmid function: TT--5510CTTG, G5386A, A4984T,A6794G.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3.5VPIII.EGFP.IGR2.1 was a gift from Harold Gainer (Addgene plasmid # 40865 ; http://n2t.net/addgene:40865 ; RRID:Addgene_40865)
  • For your References section:

    Regulatory domains in the intergenic region of the oxytocin and vasopressin genes that control their hypothalamus-specific expression in vitro. Fields RL, House SB, Gainer H. J Neurosci. 2003 Aug 27;23(21):7801-9. PubMed 12944509