p3.5VPIII.EGFP.IGR2.1
(Plasmid
#40865)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40865 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepSE280
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 11974
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMouse vasopressin gene
-
Alt nameMouse AVP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)9000
-
GenBank IDNC_000068.7
- Promoter AVP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CAAATATTCTGAAATGAGCT
- 3′ sequencing primer CTTTATCAGAAGCCAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
the following mutations are known and do not effect plasmid function: TT--5510CTTG, G5386A, A4984T,A6794G.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3.5VPIII.EGFP.IGR2.1 was a gift from Harold Gainer (Addgene plasmid # 40865 ; http://n2t.net/addgene:40865 ; RRID:Addgene_40865) -
For your References section:
Regulatory domains in the intergenic region of the oxytocin and vasopressin genes that control their hypothalamus-specific expression in vitro. Fields RL, House SB, Gainer H. J Neurosci. 2003 Aug 27;23(21):7801-9. PubMed 12944509
Map uploaded by the depositor.
