pFBOT563
(Plasmid #40864)

• Depositing Lab: Harold Gainer
• Publication: Fields et al PLoS One. 2012;7(2):e32085. Epub 2012 Feb 21.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pFastBac1
• Backbone manufacturer: invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 8000
• Vector type: Bacterial Expression, Insect Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Oxytocin promoter
• Alt name: Oxt
• Promoter: mouse oxytocin promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba I (not destroyed)
• 3′ cloning site: Xba I (not destroyed)
• 5′ sequencing primer: CCTTGCTGTTCTTCTACGGCA
• 3′ sequencing primer: aagtttaacaacaacaattgca

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The following mutations are known and do not effect function:
missing A at 6292, C6409T, A insert at 6399, C6398T, C insert at 5338, A4856C.