psiCheck2 3xUTR
(Plasmid #40762)

• Purpose: Renilla luciferase reporter containing siRNA target sites
• Depositing Lab: Phillip Zamore
• Publication: Broderick et al RNA. 2011 Oct;17(10):1858-69. Epub 2011 Aug 30.

Backbone

• Vector backbone: psiCheck2
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 6273
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3 copies of the CXCR4 small RNA target site
• Promoter: TK/SV40
• Tag / Fusion Protein:
  • luciferase (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CCAATGCTATTGTTGAAGGTGCCAAG
• 3′ sequencing primer: TCAGACAAACCCTAACCACCGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid also contains a firefly reporter cassette that has been specifically designed to be an intraplasmid transfection normalization reporter.