Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mutpRL-TK 4xUTR
(Plasmid #40759)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40759 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    mutpRL-TK
  • Backbone manufacturer
    Sharp Lab (http://web.mit.edu/sharplab/RNAi/Cloning.html)
  • Modifications to backbone
    pRL-TK (Promega) was digested with XbaI, and the following ligated in: ctagattccgagatatcggtaatgggcc This produced a modified vector, still containing an XbaI site, but now also containing an ApaI site, to allow for directional cloning of 3' UTR inserts. Final vector: TAATTctagattccgagatatcggtaatgggccCTAGA
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    4 copies of the CXCR4 small RNA target site
  • Mutation
    mutated from TAG to CTC at nt 387–389 of the Renilla luciferase open reading frame to generate mismatches with seed positions 5, 6, and 7 of the siRNA guide strand by PCR-directed mutagenesis
  • Promoter TK
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CCAATGCTATTGTTGAAGGTGCCAAG
  • 3′ sequencing primer CACTGCATTCTAGTTGTGGTTTGTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mutpRL-TK 4xUTR was a gift from Phillip Zamore (Addgene plasmid # 40759 ; http://n2t.net/addgene:40759 ; RRID:Addgene_40759)
  • For your References section:

    Argonaute protein identity and pairing geometry determine cooperativity in mammalian RNA silencing. Broderick JA, Salomon WE, Ryder SP, Aronin N, Zamore PD. RNA. 2011 Oct;17(10):1858-69. Epub 2011 Aug 30. 10.1261/rna.2778911 PubMed 21878547