phage-cmv-cfp-24xpp7
(Plasmid #40652)

• Depositing Lab: Robert Singer
• Publication: Wu et al Biophys J. 2012 Jun 20;102(12):2936-44. Epub 2012 Jun 19.

Backbone

• Vector backbone: pHAGE-CMV
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Note it is possible that the 24x PP7 repeats may recombine even in Stbl3 cells. If this occurs, try growing the plasmid at 30C instead.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CFP-24xPP7
• Alt name: 24x PP7 primer-binding site (PBS)
• Species: Synthetic
• Insert Size (bp): 2180
• Promoter: CMV
• Tag / Fusion Protein:
  • CFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: WPRE-R (5'-CATAGCGTAAAAGGAGCAACA-3')

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the final PP7 stem loop ends with CCAGCAGAGCATATGGGCTCG The depositing laboratory confirmed that the plasmid functions as described in the associated publication.

The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is:

taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt