phage-ubc-nls-ha-tdPCP-gfp
(Plasmid #40650)

• Depositing Lab: Robert Singer
• Publication: Wu et al Biophys J. 2012 Jun 20;102(12):2936-44. Epub 2012 Jun 19.

Backbone

• Vector backbone: pHAGE-UBC-RIG (modified)
• Modifications to backbone: see associated publication
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: tdPCP-gfp
• Alt name: tandem dimer PP7 bacteriophage coat protein (PCP)
• Species: Synthetic
• Insert Size (bp): 1557
• Promoter: human ubiquitin C (UBC)
• Tags / Fusion Proteins:
  • NLS (N terminal on backbone)
  • HA (N terminal on backbone)
  • EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: FUGW (5'-ATTACAGGGACAGCAGAGATCC-3')
• 3′ sequencing primer: WPRE-R (5'CATAGCGTAAAAGGAGCAACA-3')

Resource Information

• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The linker region between the two PCPs is CGTGCGGATCCGCTAGCCTCC