pXL010-Wnt dual (GFP-Fire) reporter
(Plasmid #40588)

• Depositing Lab: Sean Palecek
• Publication: Azarin et al Biomaterials. 2012 Mar;33(7):2041-9. Epub 2011 Dec 15.

Backbone

• Vector backbone: pSicoR PGK Puro
• Backbone manufacturer: addgene
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: 18 hrs at 250 rpm
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Wnt reporter sequences
• Species: H. sapiens (human), M. musculus (mouse), R. norvegicus (rat), G. gallus (chicken), B. taurus (bovine), X. laevis (frog), D. rerio (zebrafish)
• Promoter: Wnt promoter

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ccagggatttcagtcgatgt
• 3′ sequencing primer: aatctgacgcaggcagttct

Resource Information

• A portion of this plasmid was derived from a plasmid made by: 7 Tcf/Lef binding sequences are from M50 plasmid. Xiaojun (Lance) Lian cloned this dual Wnt reporter.
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This lentiviral Wnt reporter has 7 repeats of Tcf/Lef binding sites, which was cloned by Xiaojun (Lance) Lian.

Methods for Plasmid construction, lentiviral production and infection of hESCs:

The 7 TCF/LEF binding site sequences were obtained by direct PCR of plasmid M50 (Addgene plasmid 12456) and the GreenFire (GF) sequences were obtained by direct PCR of the pGreenFire1-mCMV Plasmid (System Bioscience TR010PA-1). These two sequences were cloned into pSicoR PGK puro (Addgene plasmid 11586) digested by Xba I (NEB) and Xho I (NEB). The constructed Wnt reporter plasmid was named 7TGFP and verified by sequencing. This 7TGFP vector was cotransfected with the helper plasmids psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259) into HEK-293TN cells (System Biosciences) for virus production. Virus-containing medium was collected at 48 and 72 hours after transfection and used for infection of hESCs in the presence of 6μg/mL polybrene (Sigma). Transduced cells were cultured in mTeSR1 on Matrigel for three days and then clonally isolated in mTeSR1 with 1 μg/mL puromycin.