pRS-45
(Plasmid #40586)

• Depositing Lab: Harald Schwalbe
• Publication: Silvers et al Protein Expr Purif. 2012 Jul 24;85(1):142-147.

Backbone

• Vector backbone: pET16b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5632
• Total vector size (bp): 6504
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: yTAND12-TEV-hTBPc
• Alt name: Transcription initiation factor TFIID subunit 1
• Alt name: TATA-box-binding protein
• Alt name: TBP
• Species: H. sapiens (human), S. cerevisiae (budding yeast)
• Insert Size (bp): 872
• GenBank ID: NP_011790 NP_003185
• Entrez Gene: TAF1 (a.k.a. YGR274C, KAT4, TAF130, TAF145)
• Entrez Gene: TBP (a.k.a. GTF2D, GTF2D1, HDL4, SCA17, TBP1, TFIID)
• Promoter: T7
• Tags / Fusion Proteins:
  • His-tag (N terminal on insert)
  • yTAND12 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GGGTTATGCTAGTTATTGCTCAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry