pRS-45
(Plasmid
#40586)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40586 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET16b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5632
- Total vector size (bp) 6504
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameyTAND12-TEV-hTBPc
-
Alt nameTranscription initiation factor TFIID subunit 1
-
Alt nameTATA-box-binding protein
-
Alt nameTBP
-
SpeciesH. sapiens (human), S. cerevisiae (budding yeast)
-
Insert Size (bp)872
-
GenBank IDNP_011790 NP_003185
-
Entrez GeneTAF1 (a.k.a. YGR274C, KAT4, TAF130, TAF145)
-
Entrez GeneTBP (a.k.a. GTF2D, GTF2D1, HDL4, SCA17, TBP1, TFIID)
- Promoter T7
-
Tags
/ Fusion Proteins
- His-tag (N terminal on insert)
- yTAND12 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GGGTTATGCTAGTTATTGCTCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS-45 was a gift from Harald Schwalbe (Addgene plasmid # 40586 ; http://n2t.net/addgene:40586 ; RRID:Addgene_40586) -
For your References section:
Recombinant expression and purification of human TATA binding protein using a chimeric fusion. Silvers R, Saxena K, Kudlinzki D, Schwalbe H. Protein Expr Purif. 2012 Jul 24;85(1):142-147. 10.1016/j.pep.2012.07.006 PubMed 22841618