Skip to main content
Addgene

CXN-BCL-6 ZFΔ (pCXN2-BCL6-ZFdel)
(Plasmid #40347)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40347 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCXN2
  • Backbone manufacturer
    Niwa, Yamamura, and Miyazaki (PMID: 1660837)
  • Backbone size w/o insert (bp) 5200
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BCL-6 ZFΔ
  • Alt name
    BCL-6
  • Species
    H. sapiens (human)
  • Mutation
    Contains aa1-504; ZF domain deleted (see note below)
  • Entrez Gene
    BCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
  • Promoter pCAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer pCAG-F
  • 3′ sequencing primer Bglob-pA-R (ttttggcagagggaaaaaga)
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The CXN-BCL-6 ZF deletion was made by digesting pBS-BCL-6FL with AspI, which cleaves a unique site in the human BCL-6 cDNA 45 bp before the start of the ZF domain, and HindIII, which cleaves the pBS vector. The digested plasmid was separated from the smaller deleted fragment, and ligated. The truncated cDNA was then cloned into pCXN2 via SalI and XhoI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CXN-BCL-6 ZFΔ (pCXN2-BCL6-ZFdel) was a gift from Alexander Dent (Addgene plasmid # 40347 ; http://n2t.net/addgene:40347 ; RRID:Addgene_40347)

  • For your References section:

    Repression of AP-1 function: a mechanism for the regulation of Blimp-1 expression and B lymphocyte differentiation by the B cell lymphoma-6 protooncogene. Vasanwala FH, Kusam S, Toney LM, Dent AL. J Immunol. 2002 Aug 15;169(4):1922-9. PubMed 12165517
Related items:
Commonly requested with: