pCXN2-BCL6 (CXN-BCL6)
(Plasmid #40346)

• Depositing Lab: Alexander Dent
• Publication: Vasanwala et al J Immunol. 2002 Aug 15;169(4):1922-9.

Backbone

• Vector backbone: pCXN2
• Backbone manufacturer: Niwa, Yamamura, and Miyazaki (PMID: 1660837)
• Backbone size w/o insert (bp): 5200
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BCL6
• Alt name: BCL-6
• Alt name: B-cell CLL/lymphoma 6
• Species: H. sapiens (human)
• Entrez Gene: BCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
• Promoter: pCAG
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI/SalI (destroyed during cloning)
• 3′ cloning site: SalI/XhoI (destroyed during cloning)
• 5′ sequencing primer: pCAG-F
• 3′ sequencing primer: Bglob-pA-R (ttttggcagagggaaaaaga)

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CXN-BCL-6 was constructed by inserting the human BCL-6 cDNA from pBS-BCL-6 full length (FL) via SalI ends into the XhoI site in the pCXN2 expression vector. The pCXN2 (CXN) vector was obtained from Dr. K. Ozato (National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD) and consists of the human BCL-6 cDNA driven by a hybrid
β-actin-CMV promoter.