Skip to main content
Addgene

pCGN-BCL-6Δ (pCGN-BCL6-delta)
(Plasmid #40338)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40338 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCGN
  • Backbone manufacturer
    Masafumi Tanaka and Winship Herr (PMID: 2302733)
  • Backbone size w/o insert (bp) 7500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BCL-6Δ
  • Alt name
    BCL6Δ
  • Alt name
    BCL-6
  • Alt name
    BCL6
  • Species
    H. sapiens (human)
  • Mutation
    Missing four of six zinc fingers (see note below); contains aa 1-595
  • GenBank ID
    NM_001706.4 NM_001130845.1
  • Entrez Gene
    BCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer Bglob-intron-R (TTTGCCCCCTCCATATAACA)
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The expression plasmid pCGN-BCL-6Δ was constructed by digesting the BCL-6 cDNA with EcoRI, deleting the 3' region, and cloning the remaining cDNA into pCGN. The BCL-6Δ is missing four of six zinc fingers and does not bind to a consensus BCL-6 probe in a gel shift assay (A. L. Dent, unpublished data).

Note, the cloning and ligation adds the following residues after aa595 of BCL6: RYQAYRYRRPGYR

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCGN-BCL-6Δ (pCGN-BCL6-delta) was a gift from Alexander Dent (Addgene plasmid # 40338 ; http://n2t.net/addgene:40338 ; RRID:Addgene_40338)

  • For your References section:

    BCL-6 regulates chemokine gene transcription in macrophages. Toney LM, Cattoretti G, Graf JA, Merghoub T, Pandolfi PP, Dalla-Favera R, Ye BH, Dent AL. Nat Immunol. 2000 Sep;1(3):214-20. 10.1038/79749 PubMed 10973278
Related items:
Commonly requested with: