pcDNA3.1/Puro-CAG-VSFP-CR
(Plasmid #40257)

• Depositing Lab: Michael Lin
• Publication: Lam et al Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171.

Backbone

• Vector backbone: pcDNA3.1/Puro-CAG
• Backbone manufacturer: Invitrogen/Dr. Paulmurugan Ramasamy
• Backbone size w/o insert (bp): 6107
• Total vector size (bp): 8282
• Modifications to backbone: In pcDNA3.1/Puro-CAG, the cytomegalovirus enhancer and chicken beta-actin promoter replace the cytomegalovirus enhancer-promoter of pcDNA3.1-Puro.
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: VSFP-CR
• Species: Synthetic; Ciona intestinalis
• Insert Size (bp): 2175
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: AAGGTGGTGGCTGGTGTGGC
• 3′ sequencing primer: BGH Reverse

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We amplified the voltage sensitive domain from Ciona intestinalis by PCR from Addgene plasmid 16255. The plasmid pcDNA3.1/Puro-CAG was a kind donation by Dr. Paulmurugan Ramasamy (Stanford University).
• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Voltage sensor domain of Ci-VSP fused to a pair of fluorescent proteins consisting of a Clover GFP and mRuby2 RFP.