Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1/Puro-CAG-VSFP-CR
(Plasmid #40257)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40257 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1/Puro-CAG
  • Backbone manufacturer
    Invitrogen/Dr. Paulmurugan Ramasamy
  • Backbone size w/o insert (bp) 6107
  • Total vector size (bp) 8282
  • Modifications to backbone
    In pcDNA3.1/Puro-CAG, the cytomegalovirus enhancer and chicken beta-actin promoter replace the cytomegalovirus enhancer-promoter of pcDNA3.1-Puro.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VSFP-CR
  • Species
    Synthetic; Ciona intestinalis
  • Insert Size (bp)
    2175
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
  • 3′ sequencing primer BGH Reverse
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We amplified the voltage sensitive domain from Ciona intestinalis by PCR from Addgene plasmid 16255. The plasmid pcDNA3.1/Puro-CAG was a kind donation by Dr. Paulmurugan Ramasamy (Stanford University).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Voltage sensor domain of Ci-VSP fused to a pair of fluorescent proteins consisting of a Clover GFP and mRuby2 RFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1/Puro-CAG-VSFP-CR was a gift from Michael Lin (Addgene plasmid # 40257 ; http://n2t.net/addgene:40257 ; RRID:Addgene_40257)
  • For your References section:

    Improving FRET dynamic range with bright green and red fluorescent proteins. Lam AJ, St-Pierre F, Gong Y, Marshall JD, Cranfill PJ, Baird MA, McKeown MR, Wiedenmann J, Davidson MW, Schnitzer MJ, Tsien RY, Lin MZ. Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. 10.1038/nmeth.2171 PubMed 22961245