pEG584
(Plasmid #40191)

• Depositing Lab: Geraldine Seydoux
• Publication: Griffin et al Cell. 2011 Sep 16;146(6):955-68.

Backbone

• Vector backbone: pCG150
• Backbone manufacturer: Addgene plasmid 17247
• Backbone size w/o insert (bp): 6351
• Modifications to backbone: See comment below
• Vector type: Worm Expression
• Selectable markers: unc-119 rescuing fragment

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Mex-5 (RNAi resistant)
• Alt name: Mex-5
• Species: C. elegans (nematode)
• Mutation: Exon 2 recoded to be RNAi-resistant
• GenBank ID: NM_070165.4 NP_502566.1
• Entrez Gene: mex-5 (a.k.a. CELE_W02A2.7)
• Promoter: 4.4 kb mex-5 promoter fragment
• Tags / Fusion Proteins:
  • Dendra2 PAFP (sequence optimized for worm expression; three synthetic introns inserted) (N terminal on backbone)
  • TEV protease cleavage site (N terminal on backbone)
  • S-peptide (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: DENDRA-F (GGGAACCATCGACTGAAAAA)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Dendra::MEX-5 constructs were constructed as follows. A 4.4 kb mex-5 promoter fragment based on Tenlen et al. (2008) was cloned into pDONRP4P1R (Invitrogen). Dendra2/TEV/S-peptide (Gallo et al., 2010) was cloned into pDONR201. A MEX-5 genomic fragment from the start ATG through 648 bp of 3'UTR was cloned into pDONRP2RP3. Exon 2 of mex-5 was recoded to be RNAi-resistant (Gen-Script) so as to allow depletion of endogenous MEX-5/6 without depletion of the transgene. These constructs were assembled into pCG150 using three-way Gateway system (LR reaction) (Invitrogen) (Merritt et al., 2008). Mutations were made by recombinant PCR and all inserts were sequenced verified.

Alternate plasmid name: mex-5 prom::Dendra2/TEV/Speptide::MEX-5RR - mex-5 3'UTR