pLentiEKAR2G1
(Plasmid
#40177)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti pRRL-SV40(puro)_CMV(mcs)
-
Backbone manufacturerunknown
- Backbone size w/o insert (bp) 7711
- Total vector size (bp) 9935
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameErk activity reporter
-
SpeciesSynthetic
-
Insert Size (bp)2224
- Promoter CMV
-
Tag
/ Fusion Protein
- His-Myc (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGACTCTAGAGGATCCGGAGATATACCATGG
- 3′ sequencing primer CTAGACTGCAGGATCCTGGTGATGGTGATGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKarel Svoboda, Janelia Farm Research Campus, Howard Hughes Medical Institute, Ashburn
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A genetically encoded fluorescent sensor of ERK activity. 2008. PNAS 205(49)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiEKAR2G1 was a gift from Olivier Pertz (Addgene plasmid # 40177 ; http://n2t.net/addgene:40177 ; RRID:Addgene_40177) -
For your References section:
A Versatile Toolkit to Produce Sensitive FRET Biosensors to Visualize Signaling in Time and Space. Fritz RD, Letzelter M, Reimann A, Martin K, Fusco L, Ritsma L, Ponsioen B, Fluri E, Schulte-Merker S, van Rheenen J, Pertz O. Sci Signal. 2013 Jul 23;6(285):rs12. doi: 10.1126/scisignal.2004135. 10.1126/scisignal.2004135 PubMed 23882122