pEG408
(Plasmid #40086)

• Depositing Lab: Geraldine Seydoux
• Publication: Griffin et al Cell. 2011 Sep 16;146(6):955-68.

Backbone

• Vector backbone: pIC26
• Backbone manufacturer: Cheeseman lab
• Backbone size w/o insert (bp): 16397
• Modifications to backbone: GFP replaced with Dendra2 PAFP (sequence optimized for worm expression; three synthetic introns inserted)
• Vector type: Worm Expression
• Selectable markers: unc-119

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Mex-5 (aa 345 - 468)
• Alt name: Mex-5
• Species: C. elegans (nematode)
• Insert Size (bp): 372
• Mutation: contains aa 345 - 468
• GenBank ID: NM_070165.4 NP_502566.1
• Entrez Gene: mex-5 (a.k.a. CELE_W02A2.7)
• Promoter: pie-1
• Tags / Fusion Proteins:
  • Dendra2 PFAF (N terminal on backbone)
  • TEV protease cleavage site (N terminal on backbone)
  • S-peptide (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: DENDRA-F (GGGAACCATCGACTGAAAAA)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

MEX-5 transgenes driven by the pie-1 promoter and pie-1 3'UTR were constructed by cloning the mex-5 cDNA as a SpeI fragment downstream of a Dendra2/TEV/S-peptide tag cloned into pIC26 LAP tag (Cheeseman et al., 2004).

Alternate plasmid name: pIC26 Dendra + MEX-5 (aa345-STOP) (Dendra + MEX-5 ORF)