Skip to main content
Addgene

pcDNA3.1-CD8bM-1
(Plasmid #40078)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40078 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6052
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD8β M-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    652

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer gtacctaggatgcggccgcggctgt
  • 3′ sequencing primer gccggtcgactcatttgtaaaattgtttcatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. D.R. Littman, Skirball Institute New York University School of Medicine

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-CD8bM-1 was a gift from Paula Kavathas (Addgene plasmid # 40078 ; http://n2t.net/addgene:40078 ; RRID:Addgene_40078)
  • For your References section:

    Differential expression of the human CD8beta splice variants and regulation of the M-2 isoform by ubiquitination. Thakral D, Dobbins J, Devine L, Kavathas PB. J Immunol. 2008 Jun 1;180(11):7431-42. PubMed 18490743