-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBEST-Luc
-
Backbone manufacturerPromega
- Total vector size (bp) 4486
-
Modifications to backbonepTacI promoter was removed and replaced by the bacteriophage Lambda promoter OR2-OR1-Pr, with one mutation made in this promoter. Untranslated region was removed and relplaced by UTR1, a powerful UTR (see reference related to this plasmid) Luc gene (firefly Luciferase) was removed and replaced by deGFP. A transcriptional terminator was added, called T500 (see reference related to this plasmid).
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)KL740
-
Growth instructionsGrow at 29C in strain KL740, LB medium.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedeGFP
-
Alt nameeGFP-Del6-229
-
SpeciesSynthetic
-
Insert Size (bp)678
- Promoter OR2-OR1-Pr (bacteriophage Lambda with one mutation)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TATACCATGGAGCTTTTCACTGGCG
- 3′ sequencing primer CGTGACCGCCGCCGGGATCTAACTCGAGCAAAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEST-OR2-OR1-Pr-UTR1-deGFP-T500 was a gift from Vincent Noireaux (Addgene plasmid # 40019 ; http://n2t.net/addgene:40019 ; RRID:Addgene_40019) -
For your References section:
Efficient cell-free expression with the endogenous E. Coli RNA polymerase and sigma factor 70. Shin J, Noireaux V. J Biol Eng. 2010 Jun 24;4:8. 10.1186/1754-1611-4-8 PubMed 20576148