-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 39867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiRFP protein PAS domain
- Promoter CMV
-
Tag
/ Fusion Protein
- E coil (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer ggtaggcgtgtacggtgggag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byClontech
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPAS-E was a gift from Vladislav Verkhusha (Addgene plasmid # 39867 ; http://n2t.net/addgene:39867 ; RRID:Addgene_39867) -
For your References section:
A Near-Infrared BiFC Reporter for In Vivo Imaging of Protein-Protein Interactions. Filonov GS, Verkhusha VV. Chem Biol. 2013 Jul 23. pii: S1074-5521(13)00242-1. doi: 10.1016/j.chembiol.2013.06.009. 10.1016/j.chembiol.2013.06.009 PubMed 23891149