pWA PAS-E BAD K-GAFm
(Plasmid #39866)

• Depositing Lab: Vladislav Verkhusha
• Publication: Filonov et al Chem Biol. 2013 Jul 23. pii: S1074-5521(13)00242-1. doi: 10.1016/j.chembiol.2013.06.009.

Backbone

• Vector backbone: pWA21 (modified)
• Backbone manufacturer: Wegerer, A. et al., BMC Biotechnol 8, 2 (2008)
• Total vector size (bp): 8200
• Modifications to backbone: AraC protein gene and arabinose promoter with the following MCS were added after PCR amplification from the pBAD HisB plasmid (Invitrogen)
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: iRFP protein PAS domain
• Promoter: rhamnose inducible
• Tag / Fusion Protein:
  • E coil (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: PstI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: actggtcgtagggagaccaca
• 3′ sequencing primer: gatggagcgactcgttaatcg

Gene/Insert 2

• Gene/Insert name: iRFP protein GAF domain (mutated)
• Mutation: F165Y, D232Y, W308R
• Promoter: arabinose inducible
• Tag / Fusion Protein:
  • K coil (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: ccataagattagcggatcctac

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry