pGFH-14c
(Plasmid #39541)

• Depositing Lab: Katharina Strub
• Publication: Lakkaraju et al Cell. 2008 May 2;133(3):440-51.

Backbone

• Vector backbone: pEGFP-C1P
• Total vector size (bp): 5123
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SRP14
• Species: H. sapiens (human)
• GenBank ID: X73459.1
• Entrez Gene: SRP14 (a.k.a. ALURBP)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Eco R1 (not destroyed)
• 3′ cloning site: Xma I (not destroyed)
• 5′ sequencing primer: GAAGCGCGATCACATGGTCC
• 3′ sequencing primer: GTTCAGGGGGAGGTGTGGGAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results identified nucleotide mismatches at bp# 1540, 1645, 1750 and 1774-80 when compared to the full plasmid sequence provided by the depositing laboratory. These differences are not known to affect plasmid function.