pSR9.924
(Plasmid
#39539)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 39539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSUPER.retro.puro
-
Backbone manufacturerOligoEngine
- Backbone size w/o insert (bp) 6349
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSRP9
-
gRNA/shRNA sequenceCAAGTATGCTTTGCCTTA
-
SpeciesH. sapiens (human)
-
Entrez GeneSRP9 (a.k.a. ALURBP)
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (not destroyed)
- 3′ cloning site Bgl II (destroyed during cloning)
- 5′ sequencing primer CCTTGAACCTCCTCGTTCGA
- 3′ sequencing primer GTAGCGCCAAGTGCCCAGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSR9.924 was a gift from Katharina Strub (Addgene plasmid # 39539 ; http://n2t.net/addgene:39539 ; RRID:Addgene_39539) -
For your References section:
Residues in SRP9/14 essential for elongation arrest activity of the signal recognition particle define a positively charged functional domain on one side of the protein. Mary C, Scherrer A, Huck L, Lakkaraju AK, Thomas Y, Johnson AE, Strub K. RNA. 2010 May;16(5):969-79. Epub 2010 Mar 26. 10.1261/rna.2040410 PubMed 20348448
Map uploaded by the depositor.