Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSR9.924
(Plasmid #39539)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 39539 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSUPER.retro.puro
  • Backbone manufacturer
    OligoEngine
  • Backbone size w/o insert (bp) 6349
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SRP9
  • gRNA/shRNA sequence
    CAAGTATGCTTTGCCTTA
  • Species
    H. sapiens (human)
  • Entrez Gene
    SRP9 (a.k.a. ALURBP)
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (not destroyed)
  • 3′ cloning site Bgl II (destroyed during cloning)
  • 5′ sequencing primer CCTTGAACCTCCTCGTTCGA
  • 3′ sequencing primer GTAGCGCCAAGTGCCCAGCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSR9.924 was a gift from Katharina Strub (Addgene plasmid # 39539 ; http://n2t.net/addgene:39539 ; RRID:Addgene_39539)
  • For your References section:

    Residues in SRP9/14 essential for elongation arrest activity of the signal recognition particle define a positively charged functional domain on one side of the protein. Mary C, Scherrer A, Huck L, Lakkaraju AK, Thomas Y, Johnson AE, Strub K. RNA. 2010 May;16(5):969-79. Epub 2010 Mar 26. 10.1261/rna.2040410 PubMed 20348448