Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGFH-9
(Plasmid #39538)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 39538 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SRP9
  • Species
    H. sapiens (human)
  • Entrez Gene
    SRP9 (a.k.a. ALURBP)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Eco R1 (not destroyed)
  • 3′ cloning site Bam H1 (not destroyed)
  • 5′ sequencing primer CGAGAAGCGCGATCACATGG
  • 3′ sequencing primer TCAGGGGGAGGTGTGGGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene's sequencing results identified several nucleotide mismatches from bp# 1621-1629 when compared to the full plasmid sequence provided by the depositing laboratory. These differences are not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFH-9 was a gift from Katharina Strub (Addgene plasmid # 39538 ; http://n2t.net/addgene:39538 ; RRID:Addgene_39538)
  • For your References section:

    Residues in SRP9/14 essential for elongation arrest activity of the signal recognition particle define a positively charged functional domain on one side of the protein. Mary C, Scherrer A, Huck L, Lakkaraju AK, Thomas Y, Johnson AE, Strub K. RNA. 2010 May;16(5):969-79. Epub 2010 Mar 26. 10.1261/rna.2040410 PubMed 20348448