pGFH-9
(Plasmid #39538)

• Depositing Lab: Katharina Strub
• Publication: Mary et al RNA. 2010 May;16(5):969-79. Epub 2010 Mar 26.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SRP9
• Species: H. sapiens (human)
• Entrez Gene: SRP9 (a.k.a. ALURBP)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Eco R1 (not destroyed)
• 3′ cloning site: Bam H1 (not destroyed)
• 5′ sequencing primer: CGAGAAGCGCGATCACATGG
• 3′ sequencing primer: TCAGGGGGAGGTGTGGGAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results identified several nucleotide mismatches from bp# 1621-1629 when compared to the full plasmid sequence provided by the depositing laboratory. These differences are not known to affect plasmid function.