Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TAL2079
(Plasmid #39449)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 39449 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    JDS71
  • Backbone manufacturer
    Joung lab (Addgene Plasmid # 32287)
  • Backbone size w/o insert (bp) 6447
  • Vector type
    Mammalian Expression ; T7

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP-TALEN-46-Right
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1844
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3X Flag (N terminal on backbone)
    • WT FOKI (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer CMV-F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Target binding site: TGGCGGATCTTGAAGTTCAC

To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.

It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TAL2079 was a gift from Keith Joung (Addgene plasmid # 39449 ; http://n2t.net/addgene:39449 ; RRID:Addgene_39449)
  • For your References section:

    FLASH assembly of TALENs for high-throughput genome editing. Reyon D, Tsai SQ, Khayter C, Foden JA, Sander JD, Joung JK. Nat Biotechnol. 2012 Apr 8. doi: 10.1038/nbt.2170. 10.1038/nbt.2170 PubMed 22484455