pRAJ11
(Plasmid #39244)

• Depositing Lab: Alfonso Jaramillo
• Publication: Rodrigo et al Proc Natl Acad Sci U S A. 2012 Sep 18;109(38):15271-6. Epub 2012 Sep 4.

Backbone

• Vector backbone: pSTC0
• Backbone manufacturer: Jaramillo Lab
• Backbone size w/o insert (bp): 4042
• Total vector size (bp): 4436
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RAJ11 system
• Promoter: pLlacO-1+pLtetO-1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: http://partsregistry.org/Part:pSB1AK3
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry