p2Bac.V5.p62
(Plasmid
#39218)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 39218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep2Bac
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 7125
- Total vector size (bp) 8823
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep62
-
Alt nameGTF2H1
-
Alt namegeneral transcription factor IIH, polypeptide 1, 62kDa
-
Alt nameBTF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1700
-
GenBank IDNM_001142307.1 NM_005316.3
-
Entrez GeneGTF2H1 (a.k.a. BTF2, P62, TFB1, TFIIH)
- Promoter Pp10
-
Tag
/ Fusion Protein
- V5 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site SacII (unknown if destroyed)
- 5′ sequencing primer p2Bac-F (ggacctttaattcaacccaacac)
- 3′ sequencing primer BGH_rev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2Bac.V5.p62 was a gift from Aziz Sancar (Addgene plasmid # 39218 ; http://n2t.net/addgene:39218 ; RRID:Addgene_39218)